Nevin Manimala

Int J Law Psychiatry. 2021 Apr 14;76:101700. doi: 10.1016/j.ijlp.2021.101700. Online ahead of print.

ABSTRACT

OBJECTIVE: Although drug treatment courts (DTCs) have demonstrated positive outcomes, participants with co-occurring mental health and substance use disorders (CODs) are a high-risk group that often struggle with treatment engagement not previously examined. This pilot study fills this gap by looking at six-month behavioral health and criminal justice outcomes among a hard to engage DTC COD participant sample in two Massachusetts DTCs receiving a wraparound-treatment (Maintaining Independence and Sobriety through Systems Integration, Outreach, and Networking-Criminal Justice – MISSION-CJ).

METHODS: Participants were evaluated at baseline and at six-month follow-up. Bivariate analyses examined baseline differences between clients with higher versus low engagement were examined. A mixed analysis of variance (ANOVA) for repeated measures with time as the within subject factor, and level of engagement as the between subject factor was performed for criminal justice (CJ) and behavioral health outcomes.

RESULTS: Participants were primarily male (86.6%), White (90.6%), living in unstable housing (86.2%), had an average of 18.94 years of criminal justice involvement, had an average of 15.49 years of regular illicit substance use, and mild mental health symptoms as measured by the BASIS-32 average total score (0.51), with no statistically significant differences at baseline from bivariate analyses. Mixed ANOVA results demonstrated significant effect time of time in MISSION-CJ on reducing nights in jail (p = 0.0266), opioid use (p = 0.0013), and mental health symptom (p = 0.0349). Additional improvements in nights in jail p = 0.0139), illicit substance use (p = 0.0358), and opioid use (p = 0.0013), were observed for clients that had high engagement in MISSION-CJ.

CONCLUSIONS: Wraparound services, such as MISSION-CJ, alongside DTC programming for a chronic relapsing DTC population can improve engagement in treatment and CJ and behavioral health outcomes. Future research is needed with MISSION-CJ that includes a randomized trial and a larger sample.

PMID:33864989 | DOI:10.1016/j.ijlp.2021.101700

J Surg Res. 2021 Apr 13;264:553-561. doi: 10.1016/j.jss.2021.02.027. Online ahead of print.

ABSTRACT

BACKGROUND: Postoperative nutritional therapy is of paramount importance for patients undergoing esophagectomy. The jejunostomy and nasoenteral tube are the popular routes for nutritional therapy. However, which one is the preferred route is unclear. This study aims to analyze the differences in safety and efficacy of the two routes for nutritional therapy.

MATERIALS AND METHODS: PubMed, Web of Science, Cochrane Library, and EMBASE (till September 17, 2020) were searched. The primary outcome was postoperative pneumonia. Secondary outcomes were the length of hospital stays (LOS), bowel obstruction, catheter dislocation, anastomotic leakage, overall postoperative complications, and postoperative albumin. Weighted mean differences (WMD) and odds ratios (OR) were calculated for statistical analysis.

RESULTS: Ten studies involving a total of 1,531 patients in the jejunostomy group and 1,375 patients in the nasoenteral tube group were included. Compared with patients in the nasoenteral tube group, those in the jejunostomy group had a lower incidence of postoperative pneumonia (OR = 0.68, P < 0.001), shorter LOS (WMD = -0.85, P < 0.001), and lower risk of catheter dislocation (OR = 0.15, P = 0.001). There were no significant differences in the incidence of anastomotic leakage (OR = 0.84, P = 0.43), overall postoperative complications (OR = 0.87, P = 0.59), and postoperative albumin (WMD = -0.40, P = 0.24). However, patients in the jejunostomy group had a higher risk of bowel obstruction (OR = 8.42, P = 0.002).

CONCLUSIONS: Jejunostomy for enteral nutrition showed superior outcomes in terms of postoperative pneumonia, LOS, and catheter dislocation. Jejunostomy may be the preferred enteral nutritional route following esophagectomy.

PMID:33864963 | DOI:10.1016/j.jss.2021.02.027

Int J Surg. 2021 Apr 14:105941. doi: 10.1016/j.ijsu.2021.105941. Online ahead of print.

ABSTRACT

BACKGROUND: The aim of the study was to assess the feasibility, safety, and potential benefits of four approaches of robotic assisted thyroidectomy (RT). The approaches mentioned above are also compared with traditional open thyroidectomy (OPEN).

MATERIALS AND METHODS: Medline, Embase, Cochrane library (CENTRAL) and Web of Science databases were searched up to 13^rd Dec, 2019. Data of surgical outcomes and complications were extracted to conduct the statistical analyses.

RESULTS: A total of 30 studies with 6622 patients were included. Ten were prospective study and 1 declared prospective randomized comparative study. The number of retrieved lymph nodes (LNs) in central compartment were similar between gasless transaxillary approach (GAA), bilateral axillo-breast approach (BABA) and transoral approach (OA). OPEN retrieved more LNs than BABA and OA. More metastatic LNs were seen in GAA and BABA than OA, as was for OPEN. The operation time was significantly shorter in GAA and gasless unilateral transaxillary approach (GUAA) than BABA and OA, while shortest for OPEN. Lower incidence of transient hypoparathyroidism was found in BABA than OPEN. No significant difference was observed in other indexes.

CONCLUSIONS: BABA, GAA, GUAA and OA in RT appear to be feasible and safe for patients with thyroid cancer with unique benefits. Surgical outcomes of different approaches were not identical for operation time, cosmetic effects, central neck dissection. Surgeons would consider more about patients’ will.

PMID:33864953 | DOI:10.1016/j.ijsu.2021.105941

Int J Infect Dis. 2021 Apr 14:S1201-9712(21)00345-3. doi: 10.1016/j.ijid.2021.04.035. Online ahead of print.

ABSTRACT

BACKGROUND: We examined whether existing licensed pharmacotherapies could reduce the spread of coronavirus disease 2019 (COVID-19).

METHODS: An open-label parallel randomized controlled trial was performed among healthy migrant workers quarantined in a large multi-storey dormitory in Singapore. Forty clusters (each defined as individual floors of the dormitory) were randomly assigned to receive a 42-day prophylaxis regimen of either oral hydroxychloroquine (400 mg once, followed by 200 mg/day), oral ivermectin (12 mg once), povidone-iodine throat spray (3 times/day, 270 µg/day), oral zinc (80 mg/day)/vitamin C (500 mg/day) combination, or oral vitamin C, 500 mg/day. The primary outcome was laboratory evidence of SARS-CoV-2 infection as shown by either: (1) a positive serologic test for SARS-CoV-2 antibody on day 42, or (2) a positive PCR test for SARS-CoV-2 at any time between baseline and day 42.

RESULTS: A total of 3,037 asymptomatic participants (mean age, 33.0 years; all men) who were seronegative to SARS-CoV-2 at baseline were included in the primary analysis. Follow-up was nearly complete (99.6%). Compared with vitamin C, significant absolute risk reductions (%, 98.75% confidence interval) were observed for oral hydroxychloroquine (21%, 2-42%) and povidone-iodine throat spray (24%, 7-39%). No statistically significant differences were observed with oral zinc/vitamin C combination (23%, -5 to +41%) and ivermectin (5%, -10 to +22%). Interruptions due to side effects were highest among participants who received zinc/vitamin C combination (6.9%), followed by vitamin C (4.7%), povidone-iodine (2.0%) and hydroxychloroquine (0.7%).

CONCLUSIONS: Chemoprophylaxis with either oral hydroxychloroquine or povidone-iodine throat spray was superior to oral vitamin C in reducing SARS-CoV-2 infection in young and healthy men. CLINICALTRIALS.

GOV NUMBER: NCT04446104.

PMID:33864917 | DOI:10.1016/j.ijid.2021.04.035

Am J Transplant. 2021 Apr 17. doi: 10.1111/ajt.16607. Online ahead of print.

ABSTRACT

Solid organ transplant (SOT) recipients represent a high-risk group for all SARS-COV-2 infection-related adverse outcomes. Therefore, most European countries have established prioritization of SOTrecipients in their vaccination programs. Suboptimal vaccine efficacy to the SARS-COV-2 vaccines is anticipated; however, they have been excluded from vaccination trials. Overall response rates to other vaccines as influenza have demonstrated high, though acceptable, variability.

PMID:33864722 | DOI:10.1111/ajt.16607

Diagn Cytopathol. 2021 Apr 17. doi: 10.1002/dc.24751. Online ahead of print.

ABSTRACT

BACKGROUND: The multigene genomic classifier ThyroSeq V3 has proven to be an effective triage modality in the management of indeterminate thyroid nodules. This study reports on the clinical management of patients with indeterminate thyroid nodules.

METHODS: ThyroSeq V3 testing at our institution was implemented April 1, 2019. Over a 17-month period (1 April 2019 through 31 August 2020). Thirty five indeterminate thyroid nodules were sent for testing; diagnoses included FLUS, suspicious for a follicular/Hurthle cell neoplasm (SFN/SHCN) and suspicious for papillary thyroid carcinoma (SPTC). There were 26 females, nine males; mean age 56 years. Aspirated nodules, mean size of 2 cm, were evaluated by rapid on site evaluation with adequacy assessed by the cytopathologist via telecytology.

RESULTS: Of the 35 nodules, 17 (49%) were positive and 18 (51%) were negative on ThyroSeq Testing. All of the 17 positive nodules (four FLUS, 10 SFN/SHCN, three SPTC) showed neoplastic lesions; five adenomas, one NIFTP and 11 carcinomas on surgical resection. Only 4 (22%) of the 18 nodules that were negative were resected and showed two colloid/adenomatous nodules, one NIFTP and one follicular variant of papillary thyroid carcinoma. As FLUS FNAs were the majority of the indeterminate nodules, a comparison was made pre-and post ThyroSeq testing. Prior to ThyroSeq testing the majority (69%) of the nodules were resected as compared to 36% post implementation; a statistically significant value (P < .005). Surgical resection yielded a majority of benign nodules pre-ThyroSeq testing, 68%, as compared to post-ThyroSeq testing, 25%.

CONCLUSION: Implementation of ThyroSeq V3 testing has led to improvements in clinical management of patients with indeterminate thyroid nodules.

PMID:33864719 | DOI:10.1002/dc.24751

Laryngoscope. 2021 Apr 17. doi: 10.1002/lary.29574. Online ahead of print.

ABSTRACT

OBJECTIVES: Sinonasal mucosal melanoma (SNMM) is an aggressive cancer usually managed with surgical resection. This study evaluates the impact of treatment modality and positive surgical margin (PSM) on survival following resection of SNMM.

STUDY DESIGN: Retrospective study of a national cancer registry.

METHODS: The National Cancer Database was queried for cases of SNMM from 2010 to 2015. Data regarding patient demographics, tumor staging, and treatment modality were obtained. Survival rates were compared by margin status: PSM, negative (NSM), and no operation (0SM) using Kaplan-Meier analysis and log rank test.

RESULTS: A total of 446 patients met inclusion criteria. Most cases were elderly (>66 years-old) (67.3%), female (54.3%), and white (89.5%). Cases of SNMM most commonly involved the nasal cavity (81.6%), were Stage 3 (60.0%), and underwent surgical resection at an academic center (65.0%). NSM and PSM were present in 59.0% and 26.9% of cases, respectively, while 14.1% of cases did not undergo surgical resection (0SM). Factors predictive of PSM included resection at a community hospital (OR 2.47) and Stage 4 disease (OR 2.07). The 2-year survival rates were 72.1% (95% CI 69.4-75.4%), 36.3% (95% CI 22.0-48.9), and 16.0% (95% CI 8.2-25.4%) for NSM, PSM and 0SM, respectively. Survival was statistically significant between NSM and PSM (Log rank <0.001) but not between 0SM and PSM (Log rank = 0.062).

CONCLUSION: Our study emphasizes the need for NSM for SNMM as PSM did not demonstrate any significant improvement in survival when compared to 0SM. Our findings suggest that cases of SNMM are best managed at academic centers.

LEVEL OF EVIDENCE: 4 Laryngoscope, 2021.

PMID:33864635 | DOI:10.1002/lary.29574

Int Urol Nephrol. 2021 Apr 17. doi: 10.1007/s11255-021-02862-2. Online ahead of print.

ABSTRACT

PURPOSE: Autosomal dominant polycystic kidney disease (ADPKD) is the most common genetic kidney disease and the majority of patients have a PKD-1 or PKD-2 mutation. Sirtuin 1 (SIRT1) has roles in cellular aging, antioxidant activity, cellular proliferation. In an experimental study, inhibition of SIRT1 was found to delay renal cyst development in ADPKD. The purpose of this study is to determine the SIRT1 levels in ADPKD patients. To our knowledge, this is the first study that investigating blood and urine SIRT1 levels in ADPKD patients.

METHODS: Sixty-seven patients with ADPKD and 34 control cases with normal renal functions and without renal cysts were included in this study. Serum and urine SIRT1 concentrations were determined by human enzyme-linked immunosorbent assay (ELISA) kit. 24-h urine samples were used for urine SIRT1 measurements.

RESULTS: The urine SIRT1 levels were statistically significantly lower in ADPKD patients group (p < 0.001). Although blood SIRT1 levels of ADPKD patients were higher than control cases but there were no statistically significant difference between the groups in terms of blood SIRT1 levels. Urine SIRT1 levels (β = 2.452, CI 95% 1.419-4.239, p = 0.001) were found an independent factor in multivariate regression analysis for ADPKD.

CONCLUSIONS: Urine SIRT1 levels were lower in ADPKD patients than control group. The low urinary SIRT1 levels despite the similar blood SIRT1 levels might be due to the impaired metabolism of SIRT1 in ADPKD patients; this state might has a role in cyst development.

PMID:33864594 | DOI:10.1007/s11255-021-02862-2

Mol Biol Rep. 2021 Apr 17. doi: 10.1007/s11033-021-06328-7. Online ahead of print.

ABSTRACT

On a global scale, breast cancer is the most common type of cancer in women, and it is still a growing problem. Therefore, new prognostic or diagnostic markers are required that would facilitate the assessment of patients or provide more efficient therapy, respectively. In these studies, we analyzed the contribution of LEP (2548G>A) and LEPR (109 Lys>Arg and 223Gln>Arg) genes polymorphisms to the risk of breast cancer development. The study involved 209 women aged 59.6 ± 11 years diagnosed with breast cancer and 202 healthy women aged 57.8 ± 8.2 years, who were blood donors. Polymorphism were evaluated by PCR-RFLP reaction followed by the verification of part of the samples by sequencing. The results of the study confirmed obesity as a significant breast cancer development risk factor in Polish women. However, no significant association between the studied polymorphisms and breast cancer risk or severity of the neoplastic disease was found. Interestingly, it was shown that wild type 223Gln>Gln leptin receptor (LEPR) was statistically more common in women with human epidermal growth factor receptor 2 negative (HER2-) than human epidermal groth factor receptor 2 positive (HER2+) breast cancer and wild type form of 2548G>A LEP was more common in women with progesterone receptor positive (PR+) than progesterone receptor negative (PR-) breast cancer. Studied polymorphisms of the LEP and LEPR genes do not increase breast cancer risk in the population of Polish women. However, they can affect PR an HER receptors expression and thus the severity of the disease. Noteworthy, this interesting correlation is being reported for the first time and might constitute an essential contribution to the identification of molecular mechanisms of carcinogenesis.

PMID:33864589 | DOI:10.1007/s11033-021-06328-7

Mol Biol Rep. 2021 Apr 17. doi: 10.1007/s11033-021-06323-y. Online ahead of print.

ABSTRACT

Morocco is considered as an important producer of fish with more than one million tons of small pelagic fish caught per year, along more than 3400 km of coastline. Otherwise, few studies have investigated the zoonotic parasites of fish. The purpose of this study is to determine the prevalence of Anisakis nematodes larvae in two fish species, namely sardines Sardina pilchardus and mackerel Scomber scombrus. These two species are widely consumed in Marrakesh due to their availability and their affordable prices. A total of 948 fish, including 546 sardines and 402 mackerel, were purchased from the wholesale market of Marrakesh, from January 2016 to December 2018. Sampling was performed on the days of fish arrival from the fishing areas (Dakhla, Essaouira, Safi and Sidi Ifni). The samples were examined visually for the presence of Anisakis larvae. We obtained a prevalence of 8.4% in mackerel with different rates depending on their origins (Safi: 13.23%; Essaouira: 11.66%; Sidi Ifni: 2.5%; Dakhla: 0%) and the seasons. However, no larvae were detected in the sardines after meticulous visual inspection. The detected larvae were morphologically and genetically identified. We identified the larvae by the PCR-RFLP technique using the primers LSU5-F (TAGGTCGACCCGCTGAAYTTAAGCA) and IR16-R (ATTCACACCCATTGACTCGCG) from the 28S rDNA region. The analysis showed that all larvae belong to Anisakis simplex sensu-stricto (s.s.). According to our results mackerel presents a higher risk of contamination than sardine, while statistical studies show that there is no impact of season and fishing origin on the prevalence.

PMID:33864586 | DOI:10.1007/s11033-021-06323-y