Categories
Nevin Manimala Statistics

The role of ThyroSeq V3 testing in the management of patients with indeterminate thyroid nodules on fine needle aspiration

Diagn Cytopathol. 2021 Apr 17. doi: 10.1002/dc.24751. Online ahead of print.

ABSTRACT

BACKGROUND: The multigene genomic classifier ThyroSeq V3 has proven to be an effective triage modality in the management of indeterminate thyroid nodules. This study reports on the clinical management of patients with indeterminate thyroid nodules.

METHODS: ThyroSeq V3 testing at our institution was implemented April 1, 2019. Over a 17-month period (1 April 2019 through 31 August 2020). Thirty five indeterminate thyroid nodules were sent for testing; diagnoses included FLUS, suspicious for a follicular/Hurthle cell neoplasm (SFN/SHCN) and suspicious for papillary thyroid carcinoma (SPTC). There were 26 females, nine males; mean age 56 years. Aspirated nodules, mean size of 2 cm, were evaluated by rapid on site evaluation with adequacy assessed by the cytopathologist via telecytology.

RESULTS: Of the 35 nodules, 17 (49%) were positive and 18 (51%) were negative on ThyroSeq Testing. All of the 17 positive nodules (four FLUS, 10 SFN/SHCN, three SPTC) showed neoplastic lesions; five adenomas, one NIFTP and 11 carcinomas on surgical resection. Only 4 (22%) of the 18 nodules that were negative were resected and showed two colloid/adenomatous nodules, one NIFTP and one follicular variant of papillary thyroid carcinoma. As FLUS FNAs were the majority of the indeterminate nodules, a comparison was made pre-and post ThyroSeq testing. Prior to ThyroSeq testing the majority (69%) of the nodules were resected as compared to 36% post implementation; a statistically significant value (P < .005). Surgical resection yielded a majority of benign nodules pre-ThyroSeq testing, 68%, as compared to post-ThyroSeq testing, 25%.

CONCLUSION: Implementation of ThyroSeq V3 testing has led to improvements in clinical management of patients with indeterminate thyroid nodules.

PMID:33864719 | DOI:10.1002/dc.24751

Categories
Nevin Manimala Statistics

Immunogenicity of SARS-CoV-2 BNT162b2 vaccine in solid organ transplant recipients

Am J Transplant. 2021 Apr 17. doi: 10.1111/ajt.16607. Online ahead of print.

ABSTRACT

Solid organ transplant (SOT) recipients represent a high-risk group for all SARS-COV-2 infection-related adverse outcomes. Therefore, most European countries have established prioritization of SOTrecipients in their vaccination programs. Suboptimal vaccine efficacy to the SARS-COV-2 vaccines is anticipated; however, they have been excluded from vaccination trials. Overall response rates to other vaccines as influenza have demonstrated high, though acceptable, variability.

PMID:33864722 | DOI:10.1111/ajt.16607

Categories
Nevin Manimala Statistics

LEP (-2548G>A LEP) and LEPR (223Gln>Arg, 109Lys>Arg) polymorphisms as breast cancer risk factors in the Polish female population

Mol Biol Rep. 2021 Apr 17. doi: 10.1007/s11033-021-06328-7. Online ahead of print.

ABSTRACT

On a global scale, breast cancer is the most common type of cancer in women, and it is still a growing problem. Therefore, new prognostic or diagnostic markers are required that would facilitate the assessment of patients or provide more efficient therapy, respectively. In these studies, we analyzed the contribution of LEP (2548G>A) and LEPR (109 Lys>Arg and 223Gln>Arg) genes polymorphisms to the risk of breast cancer development. The study involved 209 women aged 59.6 ± 11 years diagnosed with breast cancer and 202 healthy women aged 57.8 ± 8.2 years, who were blood donors. Polymorphism were evaluated by PCR-RFLP reaction followed by the verification of part of the samples by sequencing. The results of the study confirmed obesity as a significant breast cancer development risk factor in Polish women. However, no significant association between the studied polymorphisms and breast cancer risk or severity of the neoplastic disease was found. Interestingly, it was shown that wild type 223Gln>Gln leptin receptor (LEPR) was statistically more common in women with human epidermal growth factor receptor 2 negative (HER2-) than human epidermal groth factor receptor 2 positive (HER2+) breast cancer and wild type form of 2548G>A LEP was more common in women with progesterone receptor positive (PR+) than progesterone receptor negative (PR-) breast cancer. Studied polymorphisms of the LEP and LEPR genes do not increase breast cancer risk in the population of Polish women. However, they can affect PR an HER receptors expression and thus the severity of the disease. Noteworthy, this interesting correlation is being reported for the first time and might constitute an essential contribution to the identification of molecular mechanisms of carcinogenesis.

PMID:33864589 | DOI:10.1007/s11033-021-06328-7

Categories
Nevin Manimala Statistics

Evaluation of sirtuin 1 (SIRT1) levels in autosomal dominant polycystic kidney disease

Int Urol Nephrol. 2021 Apr 17. doi: 10.1007/s11255-021-02862-2. Online ahead of print.

ABSTRACT

PURPOSE: Autosomal dominant polycystic kidney disease (ADPKD) is the most common genetic kidney disease and the majority of patients have a PKD-1 or PKD-2 mutation. Sirtuin 1 (SIRT1) has roles in cellular aging, antioxidant activity, cellular proliferation. In an experimental study, inhibition of SIRT1 was found to delay renal cyst development in ADPKD. The purpose of this study is to determine the SIRT1 levels in ADPKD patients. To our knowledge, this is the first study that investigating blood and urine SIRT1 levels in ADPKD patients.

METHODS: Sixty-seven patients with ADPKD and 34 control cases with normal renal functions and without renal cysts were included in this study. Serum and urine SIRT1 concentrations were determined by human enzyme-linked immunosorbent assay (ELISA) kit. 24-h urine samples were used for urine SIRT1 measurements.

RESULTS: The urine SIRT1 levels were statistically significantly lower in ADPKD patients group (p < 0.001). Although blood SIRT1 levels of ADPKD patients were higher than control cases but there were no statistically significant difference between the groups in terms of blood SIRT1 levels. Urine SIRT1 levels (β = 2.452, CI 95% 1.419-4.239, p = 0.001) were found an independent factor in multivariate regression analysis for ADPKD.

CONCLUSIONS: Urine SIRT1 levels were lower in ADPKD patients than control group. The low urinary SIRT1 levels despite the similar blood SIRT1 levels might be due to the impaired metabolism of SIRT1 in ADPKD patients; this state might has a role in cyst development.

PMID:33864594 | DOI:10.1007/s11255-021-02862-2

Categories
Nevin Manimala Statistics

The Effect of Islamic Belief and Spiritual Well-being on Organ Donation in Turkey: A Descriptive-Relational Study

J Relig Health. 2021 Apr 17. doi: 10.1007/s10943-021-01252-3. Online ahead of print.

ABSTRACT

The aim of the study is to determine how Islamic belief and spiritual well-being affect the attitudes of individuals towards organ donation. The study was designed as a descriptive-relational study and included the participation of 402 adults in the eastern Mediterranean region of Turkey. For data collection, a personal information form, the Organ Donation Attitude Scale, and the Spiritual Well-being Scale were used. A statistically significant relationship was observed between the acceptance of organ donation according to Islamic beliefs and organ donation attitude. A negative relationship was found between organ donation attitude and the scores on the anomie sub-dimension of the Spiritual Well-being Scale, while a positive relationship was found between organ donation attitude and the scores on the transcendence and harmony with nature sub-dimensions. It was concluded from the results that Islamic belief and spiritual well-being have an effect on the organ donation attitudes of individuals.

PMID:33864576 | DOI:10.1007/s10943-021-01252-3

Categories
Nevin Manimala Statistics

Amniotic membrane extract eye drops for ocular surface diseases: use and clinical outcome in real-world practice

Int Ophthalmol. 2021 Apr 17. doi: 10.1007/s10792-021-01856-4. Online ahead of print.

ABSTRACT

PURPOSE: To study the indications and clinical outcomes, in a real-word setting, of amniotic membrane extract eye drops (AMEED) use for ocular surface disease (OSD).

METHODS: A retrospective study of patients treated with topical AMEED between January 2018 and January 2020 was conducted. Patients were classified in two groups according to specific OSD-dry eye disease (DED) and wound healing delay (WHD) groups. Demographics, comorbidities, treatment duration and clinical outcomes were analysed.

RESULTS: A total of 50 eyes of 36 patients with or without previous treatments were included. Patients in the DED group presented more systemic comorbidities (83 vs 22%; p < 0.001) and spent more mean time under AMEED treatment (10 vs 7.2 months average) than the WHD group (p = 0.0104). In four patients, long-term treatment (more than 24 months) was reported. Global similar symptomatic improvement was reported for both groups (DED 88.9% vs WHD 100%; p = 0.486), with the WHD group especially consisting in general relief (78%) and the DED group reporting more pain improvement (44%) (p = 0.011). Regarding patients with autologous serum as a previous treatment, no statistical differences were found in subjective or objective improvement. An overall success was achieved in 94.4% of the cases and no adverse events were found.

CONCLUSION: AMEED administration is a promising mean to treat OSD such as dry eye, persistent epithelial defect and corneal ulcers. Although AMEED may be effective in the treatment of severe DED and persistent epithelial defect or corneal ulcers, conclusions are limited owing to the absence of controlled clinical trials.

PMID:33864578 | DOI:10.1007/s10792-021-01856-4

Categories
Nevin Manimala Statistics

Prevalence and identification of Anisakis nematodes in fish consumed in Marrakesh, Morocco

Mol Biol Rep. 2021 Apr 17. doi: 10.1007/s11033-021-06323-y. Online ahead of print.

ABSTRACT

Morocco is considered as an important producer of fish with more than one million tons of small pelagic fish caught per year, along more than 3400 km of coastline. Otherwise, few studies have investigated the zoonotic parasites of fish. The purpose of this study is to determine the prevalence of Anisakis nematodes larvae in two fish species, namely sardines Sardina pilchardus and mackerel Scomber scombrus. These two species are widely consumed in Marrakesh due to their availability and their affordable prices. A total of 948 fish, including 546 sardines and 402 mackerel, were purchased from the wholesale market of Marrakesh, from January 2016 to December 2018. Sampling was performed on the days of fish arrival from the fishing areas (Dakhla, Essaouira, Safi and Sidi Ifni). The samples were examined visually for the presence of Anisakis larvae. We obtained a prevalence of 8.4% in mackerel with different rates depending on their origins (Safi: 13.23%; Essaouira: 11.66%; Sidi Ifni: 2.5%; Dakhla: 0%) and the seasons. However, no larvae were detected in the sardines after meticulous visual inspection. The detected larvae were morphologically and genetically identified. We identified the larvae by the PCR-RFLP technique using the primers LSU5-F (TAGGTCGACCCGCTGAAYTTAAGCA) and IR16-R (ATTCACACCCATTGACTCGCG) from the 28S rDNA region. The analysis showed that all larvae belong to Anisakis simplex sensu-stricto (s.s.). According to our results mackerel presents a higher risk of contamination than sardine, while statistical studies show that there is no impact of season and fishing origin on the prevalence.

PMID:33864586 | DOI:10.1007/s11033-021-06323-y

Categories
Nevin Manimala Statistics

Multi-conformation representation of Mpro identifies promising candidates for drug repurposing against COVID-19

J Mol Model. 2021 Apr 17;27(5):128. doi: 10.1007/s00894-021-04732-1.

ABSTRACT

The COVID-19 main protease (Mpro), one of the conserved proteins of the novel coronavirus is crucial for its replication and so is a very lucrative drug target. Till now, there is no drug molecule that has been convincingly identified as the inhibitor of the function of this protein. The current pandemic situation demands a shortcut to quickly reach to a lead compound or a drug, which may not be the best but might serve as an interim solution at least. Following this notion, the present investigation uses virtual screening to find a molecule which is alraedy approved as a drug for some other disease but could be repurposed to inhibit Mpro. The potential of the present method of work to identify such a molecule, which otherwise would have been missed out, lies in the fact that instead of just using the crystallographically identified conformation of the receptor’s ligand binding pocket, molecular dynamics generated ensemble of conformations has been used. It implicitly included the possibilities of “induced-fit” and/or “population shift” mechanisms of ligand fitting. As a result, the investigation has not only identified antiviral drugs like ribavirin, ritonavir, etc., but it has also captured a wide variety of drugs for various other diseases like amrubicin, cangrelor, desmopressin, diosmin, etc. as the potent possibilities. Some of these ligands are versatile to form stable interactions with various different conformations of the receptor and therefore have been statistically surfaced in the investigation. Overall the investigation offers a wide range of compounds for further testing to confirm their scopes of applications to combat the COVID-19 pandemic.

PMID:33864532 | DOI:10.1007/s00894-021-04732-1

Categories
Nevin Manimala Statistics

NMR-based metabolomics of human cerebrospinal fluid identifies signature of brain death

Metabolomics. 2021 Apr 16;17(5):40. doi: 10.1007/s11306-021-01794-3.

ABSTRACT

INTRODUCTION: Brain death (BD) is the irreversible cessation of all functions of the entire brain, including the brainstem. Cerebrospinal fluid (CSF) is a biological liquid that circulates in brain and spine. Metabolomics is able to reveal the response of biological systems to diverse factors in a specific moment or condition. Therefore, the study of this neurological condition through metabolic profiling using high resolution Nuclear Magnetic Resonance (NMR) spectroscopy is important for understanding biochemical events.

OBJECTIVES: The aim of the current study is to identify the metabolomics signature of BD using 1H-NMR spectroscopy in human CSF.

METHODS: 1H-NMR spectroscopy has been employed for metabolomic untargeted analysis in 46 CSF samples: 22 control and 24 with BD. Spectral data were further subjected to multivariate analysis.

RESULTS: Statistically significant multivariate models separated subject’s samples with BD from controls and revealed twenty one discriminatory metabolites. The statistical analysis of control and BD subjects using Orthogonal Projections to Latent Structures Discriminant Analysis (OPLS-DA) model resulted in R2X of 0.733 and Q2 of 0.635. An elevation in the concentration of statistically discriminant metabolites in BD was observed.

CONCLUSION: This study identifies a metabolic signature associated with BD and the most relevant enriched selected metabolic pathways.

PMID:33864540 | DOI:10.1007/s11306-021-01794-3

Categories
Nevin Manimala Statistics

Advanced imaging improves detection of baffle leaks and stenoses after atrial switch compared with transthoracic echocardiography

Int J Cardiovasc Imaging. 2021 Apr 17. doi: 10.1007/s10554-021-02236-w. Online ahead of print.

ABSTRACT

Current guidelines for adults with atrial switch repair recommend baseline cardiovascular magnetic resonance (CMR) for assessment of ventricular size and function, systemic and venous baffle obstruction and leaks, and valvular function. It also recommends transthoracic echocardiography (TTE) for outpatient follow up. Many such patients with implanted cardiac devices may need cardiac computed tomography (CCT) when CMR is not feasible. This study reviews and compares CMR, transesophageal echocardiography (TEE), CCT, cardiac catheterization with angiography and TTE in detection of baffle problems in patients after atrial switch operation. The medical records of patients who had at least one imaging study performed after atrial switch operation at our center from 2010 to 2020 were retrospectively reviewed. Results are reported as descriptive statistics for demographics and imaging findings. The principal outcome measure was detection of baffle leak and/or baffle stenosis. Fifty-seven patients had at least one cardiac imaging study after atrial switch operation (36 Senning and 21 Mustard operations) during the study period. Nearly 33% (19/57) had baffle complications of stenosis and/or baffle leaks identified. All 57 patients had TTE performed but baffle problems were noted by TTE in only 8 (14%) patients (7 baffle stenosis and 1 baffle leak). Of the 49 patients without known baffle problems by TTE, 24 had advanced imaging (TEE/CCT/CMR/angiography). Advanced imaging identified baffle problems in nearly half (11/24, 46%) of them (7 baffle leaks and 4 baffle stenosis). Baffle problems were present in (8/23) patients with transvenous cardiac devices. Baffle complications are common after atrial switch operations and in our study occur in 1/3rd of the patients. However, TTE is not sensitive enough to recognize these complications. Advanced imaging for detection of baffle complications should be considered in all patients after atrial switch operation.

PMID:33864562 | DOI:10.1007/s10554-021-02236-w