Categories
Nevin Manimala Statistics

The Effect of Islamic Belief and Spiritual Well-being on Organ Donation in Turkey: A Descriptive-Relational Study

J Relig Health. 2021 Apr 17. doi: 10.1007/s10943-021-01252-3. Online ahead of print.

ABSTRACT

The aim of the study is to determine how Islamic belief and spiritual well-being affect the attitudes of individuals towards organ donation. The study was designed as a descriptive-relational study and included the participation of 402 adults in the eastern Mediterranean region of Turkey. For data collection, a personal information form, the Organ Donation Attitude Scale, and the Spiritual Well-being Scale were used. A statistically significant relationship was observed between the acceptance of organ donation according to Islamic beliefs and organ donation attitude. A negative relationship was found between organ donation attitude and the scores on the anomie sub-dimension of the Spiritual Well-being Scale, while a positive relationship was found between organ donation attitude and the scores on the transcendence and harmony with nature sub-dimensions. It was concluded from the results that Islamic belief and spiritual well-being have an effect on the organ donation attitudes of individuals.

PMID:33864576 | DOI:10.1007/s10943-021-01252-3

Categories
Nevin Manimala Statistics

Amniotic membrane extract eye drops for ocular surface diseases: use and clinical outcome in real-world practice

Int Ophthalmol. 2021 Apr 17. doi: 10.1007/s10792-021-01856-4. Online ahead of print.

ABSTRACT

PURPOSE: To study the indications and clinical outcomes, in a real-word setting, of amniotic membrane extract eye drops (AMEED) use for ocular surface disease (OSD).

METHODS: A retrospective study of patients treated with topical AMEED between January 2018 and January 2020 was conducted. Patients were classified in two groups according to specific OSD-dry eye disease (DED) and wound healing delay (WHD) groups. Demographics, comorbidities, treatment duration and clinical outcomes were analysed.

RESULTS: A total of 50 eyes of 36 patients with or without previous treatments were included. Patients in the DED group presented more systemic comorbidities (83 vs 22%; p < 0.001) and spent more mean time under AMEED treatment (10 vs 7.2 months average) than the WHD group (p = 0.0104). In four patients, long-term treatment (more than 24 months) was reported. Global similar symptomatic improvement was reported for both groups (DED 88.9% vs WHD 100%; p = 0.486), with the WHD group especially consisting in general relief (78%) and the DED group reporting more pain improvement (44%) (p = 0.011). Regarding patients with autologous serum as a previous treatment, no statistical differences were found in subjective or objective improvement. An overall success was achieved in 94.4% of the cases and no adverse events were found.

CONCLUSION: AMEED administration is a promising mean to treat OSD such as dry eye, persistent epithelial defect and corneal ulcers. Although AMEED may be effective in the treatment of severe DED and persistent epithelial defect or corneal ulcers, conclusions are limited owing to the absence of controlled clinical trials.

PMID:33864578 | DOI:10.1007/s10792-021-01856-4

Categories
Nevin Manimala Statistics

Prevalence and identification of Anisakis nematodes in fish consumed in Marrakesh, Morocco

Mol Biol Rep. 2021 Apr 17. doi: 10.1007/s11033-021-06323-y. Online ahead of print.

ABSTRACT

Morocco is considered as an important producer of fish with more than one million tons of small pelagic fish caught per year, along more than 3400 km of coastline. Otherwise, few studies have investigated the zoonotic parasites of fish. The purpose of this study is to determine the prevalence of Anisakis nematodes larvae in two fish species, namely sardines Sardina pilchardus and mackerel Scomber scombrus. These two species are widely consumed in Marrakesh due to their availability and their affordable prices. A total of 948 fish, including 546 sardines and 402 mackerel, were purchased from the wholesale market of Marrakesh, from January 2016 to December 2018. Sampling was performed on the days of fish arrival from the fishing areas (Dakhla, Essaouira, Safi and Sidi Ifni). The samples were examined visually for the presence of Anisakis larvae. We obtained a prevalence of 8.4% in mackerel with different rates depending on their origins (Safi: 13.23%; Essaouira: 11.66%; Sidi Ifni: 2.5%; Dakhla: 0%) and the seasons. However, no larvae were detected in the sardines after meticulous visual inspection. The detected larvae were morphologically and genetically identified. We identified the larvae by the PCR-RFLP technique using the primers LSU5-F (TAGGTCGACCCGCTGAAYTTAAGCA) and IR16-R (ATTCACACCCATTGACTCGCG) from the 28S rDNA region. The analysis showed that all larvae belong to Anisakis simplex sensu-stricto (s.s.). According to our results mackerel presents a higher risk of contamination than sardine, while statistical studies show that there is no impact of season and fishing origin on the prevalence.

PMID:33864586 | DOI:10.1007/s11033-021-06323-y

Categories
Nevin Manimala Statistics

Multi-conformation representation of Mpro identifies promising candidates for drug repurposing against COVID-19

J Mol Model. 2021 Apr 17;27(5):128. doi: 10.1007/s00894-021-04732-1.

ABSTRACT

The COVID-19 main protease (Mpro), one of the conserved proteins of the novel coronavirus is crucial for its replication and so is a very lucrative drug target. Till now, there is no drug molecule that has been convincingly identified as the inhibitor of the function of this protein. The current pandemic situation demands a shortcut to quickly reach to a lead compound or a drug, which may not be the best but might serve as an interim solution at least. Following this notion, the present investigation uses virtual screening to find a molecule which is alraedy approved as a drug for some other disease but could be repurposed to inhibit Mpro. The potential of the present method of work to identify such a molecule, which otherwise would have been missed out, lies in the fact that instead of just using the crystallographically identified conformation of the receptor’s ligand binding pocket, molecular dynamics generated ensemble of conformations has been used. It implicitly included the possibilities of “induced-fit” and/or “population shift” mechanisms of ligand fitting. As a result, the investigation has not only identified antiviral drugs like ribavirin, ritonavir, etc., but it has also captured a wide variety of drugs for various other diseases like amrubicin, cangrelor, desmopressin, diosmin, etc. as the potent possibilities. Some of these ligands are versatile to form stable interactions with various different conformations of the receptor and therefore have been statistically surfaced in the investigation. Overall the investigation offers a wide range of compounds for further testing to confirm their scopes of applications to combat the COVID-19 pandemic.

PMID:33864532 | DOI:10.1007/s00894-021-04732-1

Categories
Nevin Manimala Statistics

NMR-based metabolomics of human cerebrospinal fluid identifies signature of brain death

Metabolomics. 2021 Apr 16;17(5):40. doi: 10.1007/s11306-021-01794-3.

ABSTRACT

INTRODUCTION: Brain death (BD) is the irreversible cessation of all functions of the entire brain, including the brainstem. Cerebrospinal fluid (CSF) is a biological liquid that circulates in brain and spine. Metabolomics is able to reveal the response of biological systems to diverse factors in a specific moment or condition. Therefore, the study of this neurological condition through metabolic profiling using high resolution Nuclear Magnetic Resonance (NMR) spectroscopy is important for understanding biochemical events.

OBJECTIVES: The aim of the current study is to identify the metabolomics signature of BD using 1H-NMR spectroscopy in human CSF.

METHODS: 1H-NMR spectroscopy has been employed for metabolomic untargeted analysis in 46 CSF samples: 22 control and 24 with BD. Spectral data were further subjected to multivariate analysis.

RESULTS: Statistically significant multivariate models separated subject’s samples with BD from controls and revealed twenty one discriminatory metabolites. The statistical analysis of control and BD subjects using Orthogonal Projections to Latent Structures Discriminant Analysis (OPLS-DA) model resulted in R2X of 0.733 and Q2 of 0.635. An elevation in the concentration of statistically discriminant metabolites in BD was observed.

CONCLUSION: This study identifies a metabolic signature associated with BD and the most relevant enriched selected metabolic pathways.

PMID:33864540 | DOI:10.1007/s11306-021-01794-3

Categories
Nevin Manimala Statistics

Advanced imaging improves detection of baffle leaks and stenoses after atrial switch compared with transthoracic echocardiography

Int J Cardiovasc Imaging. 2021 Apr 17. doi: 10.1007/s10554-021-02236-w. Online ahead of print.

ABSTRACT

Current guidelines for adults with atrial switch repair recommend baseline cardiovascular magnetic resonance (CMR) for assessment of ventricular size and function, systemic and venous baffle obstruction and leaks, and valvular function. It also recommends transthoracic echocardiography (TTE) for outpatient follow up. Many such patients with implanted cardiac devices may need cardiac computed tomography (CCT) when CMR is not feasible. This study reviews and compares CMR, transesophageal echocardiography (TEE), CCT, cardiac catheterization with angiography and TTE in detection of baffle problems in patients after atrial switch operation. The medical records of patients who had at least one imaging study performed after atrial switch operation at our center from 2010 to 2020 were retrospectively reviewed. Results are reported as descriptive statistics for demographics and imaging findings. The principal outcome measure was detection of baffle leak and/or baffle stenosis. Fifty-seven patients had at least one cardiac imaging study after atrial switch operation (36 Senning and 21 Mustard operations) during the study period. Nearly 33% (19/57) had baffle complications of stenosis and/or baffle leaks identified. All 57 patients had TTE performed but baffle problems were noted by TTE in only 8 (14%) patients (7 baffle stenosis and 1 baffle leak). Of the 49 patients without known baffle problems by TTE, 24 had advanced imaging (TEE/CCT/CMR/angiography). Advanced imaging identified baffle problems in nearly half (11/24, 46%) of them (7 baffle leaks and 4 baffle stenosis). Baffle problems were present in (8/23) patients with transvenous cardiac devices. Baffle complications are common after atrial switch operations and in our study occur in 1/3rd of the patients. However, TTE is not sensitive enough to recognize these complications. Advanced imaging for detection of baffle complications should be considered in all patients after atrial switch operation.

PMID:33864562 | DOI:10.1007/s10554-021-02236-w

Categories
Nevin Manimala Statistics

Occupational cold exposure is associated with increased reporting of airway symptoms

Int Arch Occup Environ Health. 2021 Apr 17. doi: 10.1007/s00420-021-01694-y. Online ahead of print.

ABSTRACT

OBJECTIVE: To determine if exposure to cold environments, during work or leisure time, was associated with increased reporting of airway symptoms in the general population of northern Sweden.

METHODS: Through a population-based postal survey responded to by 12627 subjects, ages 18-70, living in northern Sweden, the occurrence of airway symptoms was investigated. Cold exposure during work or leisure time was self-reported on numerical rating scales. Binary logistic regression was used to determine the statistical association between cold exposure and airway symptoms.

RESULTS: For currently working subjects (N = 8740), reporting any occupational cold exposure was associated to wheeze (OR 1.3; 95% CI 1.1-1.4); chronic cough (OR 1.2; 95% CI 1.1-1.4); and productive cough (OR 1.3; 95% CI 1.1-1.4), after adjusting for gender, age, body mass index, daily smoking, asthma, and chronic obstructive pulmonary disease. Leisure-time cold exposure was not significantly associated to reporting airway symptoms.

CONCLUSIONS: Occupational cold exposure was an independent predictor of airway symptoms in northern Sweden. Therefore, a structured risk assessment regarding cold exposure could be considered for inclusion in the Swedish workplace legislation.

PMID:33864489 | DOI:10.1007/s00420-021-01694-y

Categories
Nevin Manimala Statistics

Efficacy of phloroglucinol for acceleration of labour: a systematic review and meta‑analysis

Arch Gynecol Obstet. 2021 Apr 17. doi: 10.1007/s00404-021-06043-5. Online ahead of print.

ABSTRACT

PURPOSE: To assess the efficacy of phloroglucinol for acceleration of labour.

METHODS: Randomized controlled trials (RCTs) comparing phloroglucinol with placebo were searched in PubMed, Embase and the Cochrane Library. Literatures were collected up to April 2020. Primary outcomes were the duration of labour and average blood loss. Finally, a total of 4 RCTs, 377 patients were included in this meta-analysis. The included RCTs were analyzed by the software Rev Man 5. 3.

RESULTS: In the phloroglucinol group, the duration of the first stage was reduced by 116.04 min (95% CI 107.71 to 124.68), and the duration of the second stage was reduced by 10.75 min (95% CI 8.79 to 12.70). The average blood loss was reduced by 16.07 ml, which was statistically different from the control group.

CONCLUSION: The application of phloroglucinol is proved to be effective for accelerating the labour process, reducing the risk of maternal and neonatal complications.

PMID:33864511 | DOI:10.1007/s00404-021-06043-5

Categories
Nevin Manimala Statistics

Introduction to the Special Issue on Statistical Genetic Methods for Human Complex Traits

Behav Genet. 2021 Apr 17. doi: 10.1007/s10519-021-10057-9. Online ahead of print.

NO ABSTRACT

PMID:33864530 | DOI:10.1007/s10519-021-10057-9

Categories
Nevin Manimala Statistics

Clinical prediction is at the heart of preventing birth trauma and pelvic floor disorders for individual women

Int Urogynecol J. 2021 Apr 17. doi: 10.1007/s00192-021-04797-9. Online ahead of print.

ABSTRACT

INTRODUCTION AND HYPOTHESIS: The purpose of this article is to understand that the majority of studies investigating the role of risk factors for maternal birth trauma and pelvic floor disorders are designed using causal inferential statistical methods and have not been designed to investigate the more useful goal of clinical prediction.

METHODS: A review of the literature was conducted to describe notable causal and predictive associations between risk factors and maternal birth trauma outcomes. Examples were obtained to illustrate and contrast differences in clinical usefulness between causal and predictive models.

RESULTS: Effects of pregnancy and childbirth on the risk of maternal birth trauma outcomes and subsequent pelvic floor disorders are an area of profound investigation. Numerous observational studies provide evidence that pregnancy and childbirth play a causal role in the increasing prevalence of these outcomes, and clinicians must rely on this observational evidence to guide decisions about preventing maternal birth trauma and pelvic floor disorders. However, there are important differences between the design and evaluation of models for a predictive context including: study design goals, inclusion or exclusion of candidate risk factors, model evaluation and the additional need to assess model error.

CONCLUSION: This article contrasts how causal and predictive modeling approaches are different and argues that indiscriminately modeling risk factors for birth trauma and pelvic floor disorder outcomes is costly to women.

PMID:33864475 | DOI:10.1007/s00192-021-04797-9